14 C Research at the Laboratory for the Analysis of Radiocarbon with AMS (LARA), University of Bern

The Laboratory for the Evaluation of Radiocarbon with AMS (LARA) on the College of Bern measures the radioactive carbon isotope 14C with accelerator mass spectrometry (AMS) in numerous purposes. In addition to radiocarbon courting of environmental and archaeological samples, the LARA focuses on supply apportionment of air-borne particulate matter (i.e. aerosols) in addition to greenhouse gases corresponding to carbon dioxide and methane.
This method permits the identification and quantification of fossil carbon emissions in these air parts, which is related for measures of air-quality enchancment. The LARA moreover develops instrumental setups for and on the AMS with a view to analyze 14C samples in μg-amounts with low contamination and excessive throughput, ideally utilizing online-hyphenated programs.

A simplified SARS-CoV-2 detection protocol for analysis laboratories

Widespread testing is required to restrict the present public well being disaster attributable to the COVID-19 pandemic. A number of checks protocols have been licensed by the meals and medicines administration (FDA) beneath an emergency use authorization (EUA). Nearly all of these protocols are based mostly on the gold-standard RT-qPCR check pioneered by the U.S. Facilities for Illness Management and Prevention (CDC).
Nevertheless, there’s nonetheless a widespread lack of testing within the US and lots of the medical diagnostics protocols require intensive human labor and supplies that would face provide shortages and current biosafety considerations. Given the necessity to develop different reagents and approaches to offer nucleic-acid testing within the face of heightened demand and potential shortages, we have now developed a simplified SARS-CoV-2 testing protocol tailored for its use in analysis laboratories with minimal molecular biology gear and experience. The protocol makes use of TRIzol to purify the viral RNA from several types of medical specimens, requires minimal BSL-1 precautions and, given its excessive sensitivity, will be simply tailored to pooling samples methods.

Automation within the Life Science Analysis Laboratory

Protocols within the tutorial life science laboratory are closely reliant on the handbook manipulation of instruments, reagents and devices by a number of analysis employees and college students. In distinction to industrial and medical laboratory environments, the utilization of automation to enhance or exchange handbook duties is proscribed. Causes of this ‘automation hole’ are distinctive to tutorial analysis, with inflexible short-term funding buildings, excessive ranges of protocol variability and a benevolent tradition of funding in folks over gear.
Automation, nonetheless, can bestow a number of advantages by enhancements in reproducibility, researcher effectivity, medical translation, and security. Much less instantly apparent are the accompanying limitations, together with obsolescence and an inhibitory impact on the liberty to innovate. Rising the vary of automation choices appropriate for analysis laboratories would require extra versatile, modular and cheaper designs.
Educational and business builders of automation will more and more have to design with an environmental consciousness and an understanding that enormous high-tech robotic options will not be acceptable for laboratories with constrained monetary and spatial sources. To totally exploit the potential of laboratory automation, future generations of scientists would require each engineering and biology abilities. Automation within the analysis laboratory is more likely to be an more and more crucial element of future analysis packages and can proceed the development of mixing engineering and science experience collectively to reply novel analysis questions.

A Vital Evaluate of Alcohol Administration Tips in Laboratory Medicine Screening Analysis: Is It Time to Embody Therapy Seekers?

Human laboratory research play an necessary function in alcohol use dysfunction (AUD) remedy improvement. Drugs which might be discovered to be secure and efficient throughout human laboratory screening will then transfer to costlier medical trials in affected person populations. Given the gatekeeping function of human laboratory research within the remedy improvement pipeline, it’s crucial that these research precisely forecast how pharmacotherapies will carry out beneath true-to-life medical circumstances.
14 C Research at the Laboratory for the Analysis of Radiocarbon with AMS (LARA), University of Bern
However, the design of those research additionally should adhere to moral tips: sure points of medical actuality can’t be integrated into screening research as a result of doing so would possibly place the participant in danger for hurt or breach different moral tips. Conventions exist that information the decision of those conflicting beliefs. This text considers the apply of recruiting nontreatment-seeking heavy drinkers to take part in laboratory screening research.
By conference, volunteers are excluded from laboratory screening research that contain alcohol administration if they’re deemed “remedy in search of,” that means that they just lately stopped ingesting or are motivated to take action. Though this frequent apply could scale back danger to members, findings could not precisely predict remedy results on remedy seekers.
Certainly, there’s empirical proof that remedy seekers differ from non-treatment seekers of their responses to drugs (Ray et al., 2017; Mason et al., 2006). Right here, we argue for the significance of recruiting remedy seekers for this analysis because of their qualitative distinction from nontreatment seekers. We argue that these people must be the default inhabitants in human laboratory remedy screening research. We conclude by discussing 2 case examples of remedy experiments led by our analysis teams that concerned administering drugs to remedy seekers.

Laboratory and Numerical Evaluation of Metal Chilly-Shaped Sigma Beams Retrofitted by Bonded CFRP Tapes-Prolonged Analysis

The offered analysis is part of a broader examine of strengthening strategies intently related to cold-formed sigma metal beams with tapes made from Carbon Fiber Reinforcement Polymer/Plastic (CFRP). The offered outcomes are a continuation and extension of the checks described in earlier work by the authors and seek advice from high-slenderness thin-walled metal sigma beams subjected to a major giant rotation.
The primary concept of this expanded examine was to determine the effectiveness of CFRP tapes with respect to completely different areas, particularly at a bottom-tensioned or upper-compressed flange. Six beams with a cross-section of an Σ140 × 70 × 2.5 profile by “Blachy Pruszyński” and made from S350GD metal with a span of L = 270 cm have been examined within the four-point bending scheme. Two beams, taken as reference, have been examined with out reinforcement. The remaining beams have been bolstered with using a 50-mm huge and 1.2-mm thick Sika CarboDur S512 CFRP tape, with two beams bolstered by inserting the tape on the higher flange and two with tape positioned on the underside flange.
The CFRP tape was bonded on to the beams (by SikaDur®-30 adhesive). Laboratory checks have been aimed toward figuring out the affect of using composite tapes on the limitation of displacements and deformations of thin-walled buildings. To be able to carry out a exact measurement of displacement, which is, within the case of beams subjected to giant rotations, a really tough problem in itself, the Tritop system and two coupled lenses of the Aramis system have been used.

FCGR2A Antibody

35305-100ul 100ul
EUR 252

FCGR2A Antibody

35305-50ul 50ul
EUR 187

FCGR2A Antibody

32270-100ul 100ul
EUR 252

FCGR2A antibody

10R-4081 100 ul
EUR 691
Description: Mouse monoclonal FCGR2A antibody

FCGR2A antibody

10R-4082 100 ul
EUR 691
Description: Mouse monoclonal FCGR2A antibody

FCGR2A antibody

10R-4083 100 ul
EUR 691
Description: Mouse monoclonal FCGR2A antibody

FCGR2A antibody

10R-4084 100 ul
EUR 691
Description: Mouse monoclonal FCGR2A antibody

FCGR2A antibody

10R-4085 100 ul
EUR 691
Description: Mouse monoclonal FCGR2A antibody

FCGR2A antibody

10R-4086 100 ul
EUR 691
Description: Mouse monoclonal FCGR2A antibody

FCGR2A antibody

10R-4087 100 ul
EUR 691
Description: Mouse monoclonal FCGR2A antibody

FCGR2A antibody

10R-4088 100 ul
EUR 691
Description: Mouse monoclonal FCGR2A antibody

FCGR2A antibody

10R-4089 100 ul
EUR 691
Description: Mouse monoclonal FCGR2A antibody

FCGR2A antibody

10R-4090 100 ul
EUR 691
Description: Mouse monoclonal FCGR2A antibody

FCGR2A antibody

10R-4091 100 ul
EUR 726
Description: Mouse monoclonal FCGR2A antibody

FCGR2A antibody

70R-17272 50 ul
EUR 435
Description: Rabbit polyclonal FCGR2A antibody

FCGR2A Antibody

DF4801 200ul
EUR 304
Description: FCGR2A Antibody detects endogenous levels of total FCGR2A.

FCGR2A Antibody

DF6402 200ul
EUR 304
Description: FCGR2A Antibody detects endogenous levels of total FCGR2A.

FCGR2A Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FCGR2A. Recognizes FCGR2A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FCGR2A Antibody

CSB-PA985077-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FCGR2A. Recognizes FCGR2A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FCGR2A Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FCGR2A. Recognizes FCGR2A from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

FCGR2A Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FCGR2A. Recognizes FCGR2A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FCGR2A Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCGR2A. Recognizes FCGR2A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

FCGR2A Conjugated Antibody

C32270 100ul
EUR 397

FCGR2A Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FCGR2A Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FCGR2A Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-FCGR2A Antibody

A01450-1 100ug/vial
EUR 334

Anti-FCGR2A antibody

STJ23641 100 µl
EUR 277
Description: This gene encodes one member of a family of immunoglobulin Fc receptor genes found on the surface of many immune response cells. The protein encoded by this gene is a cell surface receptor found on phagocytic cells such as macrophages and neutrophils, and is involved in the process of phagocytosis and clearing of immune complexes. Alternative splicing results in multiple transcript variants.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FCGR2A Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCGR2A. Recognizes FCGR2A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FCGR2A Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCGR2A. Recognizes FCGR2A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FCGR2A Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCGR2A. Recognizes FCGR2A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FCGR2A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV670388 1.0 ug DNA
EUR 514

FCGR2A Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV710098 1.0 ug DNA
EUR 316

FCGR2A cloning plasmid

CSB-CL008540HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 951
  • Sequence: atgactatggagacccaaatgtctcagaatgtatgtcccagaaacctgtggctgcttcaaccattgacagttttgctgctgctggcttctgcagacagtcaagctgctcccccaaaggctgtgctgaaacttgagcccccgtggatcaacgtgctccaggaggactctgtgactct
  • Show more
Description: A cloning plasmid for the FCGR2A gene.

FCGR2A cloning plasmid

CSB-CL008540HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 951
  • Sequence: atgactatggagacccaaatgtctcagaatgtatgtcccagaaacctgtggctgcttcaaccattgacagttttgctgctgctggcttctgcagacagtcaagctgctcccccaaaggctgtgctgaaacttgagcccccgtggatcaacgtgctccaggaggactctgtgactct
  • Show more
Description: A cloning plasmid for the FCGR2A gene.

FCGR2A Rabbit pAb

A1388-100ul 100 ul
EUR 308

FCGR2A Rabbit pAb

A1388-200ul 200 ul
EUR 459

FCGR2A Rabbit pAb

A1388-20ul 20 ul
EUR 183

FCGR2A Rabbit pAb

A1388-50ul 50 ul
EUR 223

FCGR2A Blocking Peptide

DF4801-BP 1mg
EUR 195

FCGR2A Blocking Peptide

DF6402-BP 1mg
EUR 195

Polyclonal PIG3 Antibody (C-term)

APR09276G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PIG3 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SGMS2 Antibody (C-term)

APR09908G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SGMS2 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SGMS2 Antibody (C-term)

APR09909G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SGMS2 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SIRT3 Antibody (C-Term)

APR09957G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SIRT3 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal SIRT5 Antibody (C-term)

APR09965G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SIRT5 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SIRT6 Antibody (C-term)

APR09972G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SIRT6 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SLC16A3 Antibody (C-term)

APR09984G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLC16A3 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SLC10A1 Antibody (C-term)

APR09991G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLC10A1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SLC22A1 Antibody (C-term)

APR10012G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLC22A1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SLC22A6 Antibody (C-Term)

APR10021G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLC22A6 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal SLC26A4 Antibody (C-Term)

APR10040G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLC26A4 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal SLC2A1 Antibody (C-term)

APR10053G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLC2A1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SLC2A3 Antibody (C-Term)

APR10060G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLC2A3 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal SLC2A4 Antibody (C-term)

APR10066G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLC2A4 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SLC2A4 Antibody (C-term)

APR10067G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLC2A4 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SLC3A2 Antibody (C-term)

APR10104G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLC3A2 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SLC47A1 Antibody (C-term)

APR10110G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLC47A1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SLC5A12 Antibody (C-term)

APR10131G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLC5A12 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SLC5A8 Antibody (C-Term)

APR10137G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLC5A8 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal SOD3 Antibody (C-term)

APR10199G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOD3 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SPR Antibody (C-term)

APR10223G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPR (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SRD5A2 Antibody (C-Term)

APR10235G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SRD5A2 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal STAT1 Antibody (C-term)

APR10263G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STAT1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal STAT5A Antibody (C-Term)

APR10276G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human STAT5A (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal STAT5A Antibody (C-term)

APR10277G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STAT5A (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal STAT5b Antibody (C-term)

APR10280G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STAT5b (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal STC1 Antibody (C-term)

APR10288G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STC1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal STIM1 Antibody (C-term)

APR10301G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STIM1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SULF2 Antibody (C-term)

APR10328G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SULF2 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SULT1A1 Antibody (C-term)

APR10330G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SULT1A1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SULT1A1 Antibody (C-term)

APR10331G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SULT1A1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SULT1B1 Antibody (C-term)

APR10333G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SULT1B1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal SULT2A Antibody (C-term)

APR10334G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SULT2A (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal TAC1 Antibody (C-term)

APR10371G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TAC1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal TFAM Antibody (C-term)

APR10397G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TFAM (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal TFB1M Antibody (C-Term)

APR10412G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TFB1M (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal TFB2M Antibody (C-Term)

APR10415G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TFB2M (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal TGM2 Antibody (C-Term)

APR10428G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TGM2 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal TGM3 Antibody (C-term)

APR10429G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TGM3 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal TGM5 Antibody (C-term)

APR10434G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TGM5 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal TH Antibody (C-term)

APR10445G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TH (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal TMEM49 Antibody (C-term)

APR10490G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMEM49 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal TMM70 Antibody (C-term)

APR10493G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMM70 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal TMX3 Antibody(C-term)

APR10494G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMX3 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal TPI1 Antibody (C-term)

APR10520G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TPI1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal TRPM4 Antibody (C-term)

APR10549G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRPM4 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal TRH Antibody (C-Term)

APR10559G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRH (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal TXN Antibody (C-term)

APR10586G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TXN (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal TST Antibody (C-Term)

APR10594G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TST (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal TXNRD1 Antibody (C-Term)

APR10615G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TXNRD1 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal TYSY Antibody(C-term)

APR10627G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TYSY (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal UGT1A9 Antibody (C-Term)

APR10631G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UGT1A9 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal UGT2B11 Antibody (C-term)

APR10634G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UGT2B11 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal UCK Antibody (C-term)

APR10642G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UCK (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal UGDH Antibody (C-term)

APR10653G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UGDH (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal UPP1 Antibody (C-Term)

APR10662G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UPP1 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal UQCRFS1 Antibody (C-term)

APR10672G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UQCRFS1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal VAPA Antibody(C-term)

APR10690G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VAPA (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal VAPB Antibody (C-term)

APR10691G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VAPB (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal VAT1L Antibody (C-term)

APR10693G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VAT1L (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal VEGF Antibody (C-term)

APR10711G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VEGF (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal VHL Antibody (C-term)

APR10723G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VHL (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal WBSCR17 Antibody (C-term)

APR10734G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WBSCR17 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal WBSCR22 Antibody (C-term)

APR10735G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WBSCR22 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal ZDHHC18 Antibody (C-Term)

APR10778G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ZDHHC18 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal SUMO1 Antibody (C-term)

APR10805G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUMO1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal ATG16L Antibody (C-term)

APR10811G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG16L (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal ABCB11 Antibody (C-term)

APR10814G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ABCB11 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal ATG7 Antibody (C-term)

APR10816G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG7 (C-term). This antibody is tested and proven to work in the following applications:
Electrofusion pressure gauges have been used to measure the deformation. Within the subsequent step, numerical fashions of the analyzed beams have been developed within the Abaqus program. Good compliance of the outcomes of laboratory checks and numerical analyses was achieved. The obtained outcomes verify the useful impact of using tapes (CFRP) on the discount in displacements and deformations of metal cold-formed components.

Leave a Reply

Your email address will not be published.